rna2dna

Convert RNA sequence to DNA sequence

Syntax

SeqDNA = rna2dna(SeqRNA)

Description

SeqDNA = rna2dna(SeqRNA) converts an RNA sequence to a DNA sequence by replacing uracil (U) nucleotides with thymine (T) nucleotides.

Examples

Convert RNA Sequence to DNA Sequence

Generate a random RNA sequence.

rna = randseq(100,Alphabet='rna')

rna = 
'UUAUGACGUUAUUCUACUUUGAUUGUGCGAGACAAUGCUACCUUACCGGUCGGAACUCGAUCGGUUGAACUCUAUCACGCCUGGUCUUCGAAGUUAGCAC'

Convert the RNA sequence to a DNA sequence.

dna = rna2dna(rna)

dna = 
'TTATGACGTTATTCTACTTTGATTGTGCGAGACAATGCTACCTTACCGGTCGGAACTCGATCGGTTGAACTCTATCACGCCTGGTCTTCGAAGTTAGCAC'

Input Arguments

SeqRNA — RNA sequence

character vector | string scalar | row vector of integers | structure

RNA sequence, specified as one of the following.

• Character vector or string scalar consisting of the characters A, C, G, and U, and ambiguous characters R, Y, K, M, S, W, B, D, H, V, and N.

• Row vector of integers specifying a nucleotide sequence. For information on valid integers, see Mapping Nucleotide Integers to Letter Codes.

• Structure that contains an RNA sequence in the Sequence field. The fastaread, fastqread, emblread, getembl, genbankread, and getgenbank functions return structures with a Sequence field.

Example: SeqDNA = dna2rna("CGACUU") replaces the instances of U with T.

Data Types: double | char | string | struct

Output Arguments

SeqDNA — DNA sequence

character vector | row vector of integers

DNA sequence, returned as a character vector or a row vector of integers.

• If SeqRNA is a character vector or string scalar, then the function returns a character vector.

• If SeqRNA is a row vector of integers, then the function returns a row vector of integers.

• If SeqRNA is a structure, then the function returns SeqDNA with the same data type as the Sequence field, either a character vector or a row vector of integers.

Version History

Introduced before R2006a