Réponse apportée
Plotting data from struct array
Here is one simple example: t1 = linspace(-pi, pi, 200); t2 = linspace(-pi, pi, 500); f1 = 2*sin(t1); f2 = 3*cos(t1); f3 ...

environ 3 ans il y a | 0

Réponse apportée
How can I change the font size of the current axis?
There is one minor correction with one of the otptions proposed by @Mat Fig using fontsize() the unit has to be specified: x = ...

environ 3 ans il y a | 0

Réponse apportée
How do I take my generated string outputs from for loop and return a list?
Here si the solution: a=[]; seq = 'ACAUUUGCUUCUGACACAACUGUGUUCACUAGCAACCUCAAACAGACA' for i=1:3:numel(seq)-2 a = [a; (se...

environ 3 ans il y a | 0

Réponse apportée
How to replace the values of a vector from desired location to its end?
The err in your code is with 0 in b's index that is not acceptable. Because b(0) does not exist. Which element of b vector are y...

environ 3 ans il y a | 0

Réponse apportée
how to optimize a sweep for solving inequalities?
One of the possible ways to speed up your code is to get rid of display of resuts. Instead storing them, e.g.: syms ki kd i0 ...

environ 3 ans il y a | 0

Réponse apportée
Solve a nonlinear function with one variable
It is quite simple to solve this exercise. Just use vpasolve(), e.g.: syms x Solution = vpasolve(x-x^2+2*sin(x)*(x-1)==0) An ...

environ 3 ans il y a | 1

Réponse apportée
How do I remove the Ans from the result
You'd need to use either display or fprintf not to have ans, e.g.: %% fprintf if Alpha(1,1) == 1 fprintf('Ok \n') else Al...

environ 3 ans il y a | 0

Réponse apportée
Error using logical operators on a string input
Here is the corrected part of your code. Note that you'd need to get a single value logical in order to compare the two differe...

environ 3 ans il y a | 0

Réponse apportée
When I use vpasolve I get all variables as [0x1 sym], any input as to what the problem might be would be appreciated!
The problem here is that you have defined 4 equations and trying to solve for 5 unknowns (beta1, beta2 beta3 M2, M3) that is inc...

environ 3 ans il y a | 0

| A accepté

Réponse apportée
Solve a multiobjective optimization problem by problem-based approach in Matlab2021a
It is working ok: % teste_multiobjective file x1 = optimvar('x1','LowerBound',0); x2 = optimvar('x2','LowerBound',0); s1 = 5...

environ 3 ans il y a | 0

Réponse apportée
Why the color of bar plot of elementary effects is so light?
x = 1:11; y = [75 91 105 123.5 131 150 179 203 226 249 281.5]; bar(x, y, 'r')

environ 3 ans il y a | 0

Réponse apportée
How to split dataset into 2/3 for training and 1/3 for testing include plot the graph?
You should use random partition of your total data set, e.g.: rng("default"); % For reproducibility n = length(X); % C = ...

environ 3 ans il y a | 0

Réponse apportée
modelling permanent magnet motor
Yes, definitely it is feasible. You can do some regression analysis and then compare with the existing/builtin MATLAB/Simulink m...

environ 3 ans il y a | 0

Réponse apportée
Why simulink double click or block properties respond slow
There might be a few different reasons for that. (1) Something is running on the back.If your model is computationally heavy an...

environ 3 ans il y a | 0

Réponse apportée
How to get pack ego actor matlab function
If you have this model shown in this screen shot, then just double click on the MATLAB fcn block and then use the syntax of that...

environ 3 ans il y a | 0

Réponse apportée
Data in groups to new table
(1) Import the data into MATLAB: D = readmatrix('Data.xlsx'); (2) Convert to date time: DTime = datetime(D(:,1), D(:,2), D(:,...

environ 3 ans il y a | 0

Réponse apportée
Not enough input arguments.
In your A_new, you should have vecnorm known in A_new. If vecnorm() is a norm of a vector x that you are trying to compute, then...

environ 3 ans il y a | 0

Réponse apportée
goodness of fit data for a fit
From your posted link, you can see that: (1) x is: x = lisqcurvefit(...) gives you the found fit model coefficients. E.g.: fr...

environ 3 ans il y a | 0

Réponse apportée
from an array, creating a row vector of elements but one row is in reverse order
Eg.: A = [ 1, 2 3; 4 5 6; 7 8 9] % Extract Row 1 a1 = A(1,:); % Extract Row 3 a3 = A(3.:); % Reverse Row 1 a1 = fliplr(a1...

environ 3 ans il y a | 0

Réponse apportée
from an array, creating a row vector of elements but one row is in reverse order
Use : and fliplr(). See DOC1 and DOC2.

environ 3 ans il y a | 0

Réponse apportée
How Could I change cases name and direction in confusion matrix?
You can try xtickangle(), ytickangle()

environ 3 ans il y a | 0

Réponse apportée
Where to find the marginal R-squared from a Linear-Mixed Effects model?
It does not have the marginal R-squared, and thus, you'd need to compute using the values from the prdicted values - see this DO...

environ 3 ans il y a | 0

| A accepté

Réponse apportée
Unable to set the scale fro -inf to inf
Note that [inf -inf] will make your plot hardly visible and thus, you had better take a bit larger values to the two extreme po...

environ 3 ans il y a | 0

Réponse apportée
How to detect the inner part of the core?
Have you seen the code proposed by Image Analyst: https://www.mathworks.com/matlabcentral/answers/245026-shape-detection-in-imag...

environ 3 ans il y a | 0

Réponse apportée
How to use function "totalreturnprice"?
To understand and see how this function works, it is better to look inside of this function. That can be achieved with the follo...

environ 3 ans il y a | 0

Réponse apportée
How to customize Colorbar on map?
If you want to change a tickmarks only, then : [X,Y] = meshgrid(-7:.25:7.5); Z1 = X.^2 + Y.^2; Z2 = Z1 + 10; figure surf(X,...

environ 3 ans il y a | 0

Réponse apportée
Index exceeds the number of array elements. Index must not exceed 512.
It is easier to check the syntaxes if these function files are put into one M-file and executed as whole one file (in my opinion...

environ 3 ans il y a | 0

Réponse apportée
Loading a file into a variable in funtion
How you can call a function to load a data file, e.g.: FName = 'MY_data'; % .txt data files that all contain the sequential nam...

environ 3 ans il y a | 0

Réponse apportée
Please help, I don't understand the error. How I can make it correct?
There are a few crucial points overlooked in your code. (1) Placement of input entries (2) Placement of functions (SIRSol, SIR...

environ 3 ans il y a | 1

Réponse apportée
How to get the RGB values of each point on a surface when illuminated by 'light' objects?
If understood your question correctly, this might be the solution: ... s.SpecularStrength = 1; s.SpecularColorReflectance = 1...

environ 3 ans il y a | 0