Contenu principal

rnafold

R2026b

Predict minimum free-energy secondary structure of RNA sequence

Description

rnafold(Seq) predicts and displays the secondary structure (in bracket notation) associated with the minimum free energy for the RNA sequence, Seq, using the thermodynamic nearest-neighbor approach.

Note

For long sequences, this prediction can be time consuming. For example, a 600-nucleotide sequence can take several minutes, and sequences greater than 1000 nucleotides can take over 1 hour, depending on your system.

RNAbracket = rnafold(Seq) returns the secondary structure associated with the minimum free energy for the RNA sequence, Seq, using the thermodynamic nearest-neighbor approach. The returned structure, RNAbracket, is in bracket notation, that is a vector of dots and brackets. Each dot represents an unpaired base, while a pair of equally nested, opening and closing brackets represents a base pair.

[RNAbracket,Energy] = rnafold(Seq) returns Energy, the energy value (in kcal/mol) of the minimum free-energy secondary structure of the RNA sequence.

[RNAbracket,Energy,RNAmatrix] = rnafold(Seq) returns RNAmatrix, a connectivity matrix representing the secondary structure associated with the minimum free energy. RNAmatrix is an upper triangular matrix where RNAmatrix(i, j) = 1 only if the ith residue in the RNA sequence Seq is paired with the jth residue of Seq.

___ = rnafold(Seq,Name=Value) specifies options using one or more name-value arguments in addition to the input arguments in previous syntaxes. Each name-value argument is case insensitive.

example

Examples

collapse all

This example shows how to determine the minimum free-energy secondary structure (in both bracket and matrix notation) and the energy value of the 'ACCCCCUCCUUCCUUGGAUCAAGGGGCUCAA' RNA sequence.

seq = 'ACCCCCUCCUUCCUUGGAUCAAGGGGCUCAA';
[bracket,energy,matrix] = rnafold(seq);
bracket
bracket = 
'..(((((...((....))...))))).....'

Input Arguments

collapse all

RNA sequence, specified as a character vector, string, or MATLAB structure.

Example: 'ACCCCCUCCUUCCUUGGAUCAAGGGGCUCAA'

Data Types: char | string

Name-Value Arguments

collapse all

Specify optional pairs of arguments as Name1=Value1,...,NameN=ValueN, where Name is the argument name and Value is the corresponding value. Name-value arguments must appear after other arguments, but the order of the pairs does not matter.

Example: MinLoopSize=3

Minimum size of the loops (in bases) to be considered when computing free energy, specified as an integer.

Example: MinLoopSize=3

Data Types: single | double

Prevent GU or UG pairs from forming, specified as false or true. Specify true to allow GU and UG pairs to form.

Example: NoGU='true'

Control display of progress bar during the computation of the minimum free-energy secondary structure, specified as false or true. Specify true to show progress bar.

Example: Progress='false'

Output Arguments

collapse all

Bracket notation for minimum-free energy secondary structure of RNA sequence, returned as a bracket of dots and brackets indicating the bracket notation. In the bracket notation, each dot represents an unpaired base, while a pair of equally nested, opening and closing brackets represents a base pair.

Energy of minimum free-energy secondary structure of RNA sequence in kcal/mol, returned as a scalar.

Connectivity matrix representing the minimum free-energy secondary structure of an RNA sequence, returned as a binary, upper-triangular matrix, where RNAmatrix(i, j) = 1. if and only if the ith residue in the RNA sequence Seq is paired with the jth residue of Seq.

References

[1]

[2] Wuchty, S., Fontana, W., Hofacker, I., and Schuster, P. (1999). Complete suboptimal folding of RNA and the stability of secondary structures. Biopolymers 49, 145–165.

[3] Matthews, D., Sabina, J., Zuker, M., and Turner, D. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288, 911–940.

Version History

Introduced in R2007b