Decoding DNA sequence into binary

I have a sequence TGACTCAGTCGTTCAATCTATGCC, how to write code in matlab to convert it into binary? Please help me..Thank you

[James Tursa]

Please give an example of what exact output you would like for the above sequence.

[Meghashree G]

The output should be 01100011 01110010 01111001 01110000 01110100 01101111

( A=00 T=01 G=10 C=11)

[Dabba Do]

IF: every A matches to a T, THEN: the output for an A or a T is the same. The same is true of G and C they are a pair. So there are only two pairs, why not try defining each pair as a 1 or a 0. So if A and T = 1 and G and C = 0 then: the sequence TGACTCAGTGTTCAATCTATGCC would be: 101010101001101110111000. By coding each codon with a 1 and a 0 you are going to con-volute the Bits in your code and they work as pairs representing a single genetic Bit.

Answer 1

[James Tursa]

One way:

s = 'TGACTCAGTCGTTCAATCTATGCC';  % Input DNA string
[~,x] = ismember(s,'ATGC');  % Convert the ATGC into indexes
c = {'00','01','10','11'};  % Numeric strings to convert the indexes into
result = cell2mat(c(x));  % Convert the indexes into the numeric strings

[Meghashree G]

Thank you so much :)

Answer 2

[Bastien Chardonnens]

You can use

    str = ('TGACTCAGTCGTTCAATCTATGCC');
    [~,~,ind] = unique(double(str)-65);
    dec2bin(ind-1)

Answer 3

[Suresma Jena]

i want to how to convert a DNA sequence into binary. ex- if x = ATGCAT then its binary sequence will be xA = 100010 xT = 010001 xG = 001000 xC = 000100

[James Tursa]

x = 'ATGCAT';
xA = x == 'A';
xT = x == 'T';
xG = x == 'G';
xC = x == 'C';

Results will be logical. If you want character results then you can add '0' to the above lhs variables and convert to char. E.g.,

xA = char((x == 'A') + '0');
xT = char((x == 'T') + '0');
xG = char((x == 'G') + '0');
xC = char((x == 'C') + '0');

[SUBHAJIT KAR]

I have a DNA sequence in FASTA format. I want to convert this DNA sequence into two bit binary sequence such that a sequence reading x=' ATCGA' will be converted into '0001101100'. the coding will be A=00, C=01,G=10 and G=11. please send suggestions.

[Walter Roberson]

Use the method James showed https://www.mathworks.com/matlabcentral/answers/244696-decoding-dna-sequence-into-binary#answer_193507

[SUBHAJIT KAR]

Can I replace a text file which contain the string with s ?

[Walter Roberson]

s = fileread('NameOfTextFileGoesHere');

[lakshmi boddu]

A pseudo random binary sequence of size 256 * 256 is generated with two 1 D logistic maps , from which 3-bit disjoint and consecutive binary sequences are extracted to choose DNA coding rule, as follows 000 ( 00-A,01-C 10-G,11-T) 001(00-A,01-G,10-C,11-T) 010(00-C,01-A,10-T,11-G) 011( 00-C ,01-T,10-A,11-G) 100( 00-G, 01-A,10-T,11-C) 101(00-G,01-T,10-A, 11-C) 110(00-T,01-C,10-G,11-A) 111( 00-T,01-G,10-C,11-A) . please help me sir how to implement in matlab

Answer 4

[Siyab Khan]

Please also write code for DNA sequencig in 4 bits

via this given schema

4 2 1 0

N = 0 0 0 1 N represents the gap in DNA sequence

A = 0 1 0 0

T = 1 0 0 0

C = 0 0 1 0

G = 0 1 1 0

Answer 5

[Khaled belkacemi]

Hello,can someone help me to do the code for this situation? example of input data:0121212002202021101110002

and i want to code my data as this array