Statistiques
0 Questions
3 Réponses
RANG
10 603
of 300 338
RÉPUTATION
4
CONTRIBUTIONS
0 Questions
3 Réponses
ACCEPTATION DE VOS RÉPONSES
0.00%
VOTES REÇUS
0
RANG
of 20 922
RÉPUTATION
N/A
CLASSEMENT MOYEN
0.00
CONTRIBUTIONS
0 Fichier
TÉLÉCHARGEMENTS
0
ALL TIME TÉLÉCHARGEMENTS
0
RANG
of 168 149
CONTRIBUTIONS
0 Problèmes
0 Solutions
SCORE
0
NOMBRE DE BADGES
0
CONTRIBUTIONS
0 Publications
CONTRIBUTIONS
0 Public Chaîne
CLASSEMENT MOYEN
CONTRIBUTIONS
0 Point fort
NOMBRE MOYEN DE LIKES
Feeds
Decoding DNA sequence into binary
You can use str = ('TGACTCAGTCGTTCAATCTATGCC'); [~,~,ind] = unique(double(str)-65); dec2bin(ind-1)
environ 10 ans il y a | 0
List toolboxes currently in use by session
The function ver will give you this information
environ 10 ans il y a | 0
plotting general form of function
You can plot a symbolic expression with ezplot(sym_fun)
environ 10 ans il y a | 0
| A accepté

