How to get all possible rearrange permutations of array with repeated elements?
2 vues (au cours des 30 derniers jours)
Afficher commentaires plus anciens
I have some DNA sequences to rearrange
'ACTCACATCTGGTTCCTCTA'
and I need all possible permutations of this (4 'A', 7 'T', 7 'C', 2 'G'). For example,
'AAAATTTTTTTCCCCCCCGG',
'AAATATTTTTTCCCCCCCGG',
'AATAATTTTTTCCCCCCCGG',
...
I used
unique(perms('ACTCACATCTGGTTCCTCTA'),'rows');
It works for smaller array. But for this array, it results error because perms with 20 elements takes up too much memory ( numel is 20! = 2.43e+18).
Actual numbers of permutation would be 20!/4!/7!/7!/2! = 2.00e+09. It's a lot, but still it fits on my memory.
So is there any better way?
0 commentaires
Réponse acceptée
Plus de réponses (0)
Voir également
Catégories
En savoir plus sur Matrices and Arrays dans Help Center et File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!