Now I have to convert the DNA sequence into complex number.
what i did was :
s=randseq(20) % to have random sequence of DNA consisting of ATCG s=
ATCGCGCGATATATCGCGCG
next, I am stuck. the thing is, i need to convert each letter to complex. for example, A=-1+1i T=1-1i C=-1=1i G=1+1i
i need to convert and map the sequence into complex to use it after that in daubechies wavelet.
Thank you

Réponses (1)

David Young
David Young le 21 Fév 2015
values('ATCG') = [-1+1i 1-1i -1-1i 1+1i]; % mapping from characters to complex
s = 'ATCGCGCGATATATCGCGCG'; % any specific sequence
scomplex = values(s); % the sequence represented as complex numbers

Catégories

En savoir plus sur Genomics and Next Generation Sequencing dans Centre d'aide et File Exchange

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Translated by