Decoding DNA sequence into binary
42 vues (au cours des 30 derniers jours)
Afficher commentaires plus anciens
Meghashree G
le 23 Sep 2015
Modifié(e) : Khaled belkacemi
le 4 Avr 2022
I have a sequence TGACTCAGTCGTTCAATCTATGCC, how to write code in matlab to convert it into binary? Please help me..Thank you
3 commentaires
Dabba Do
le 14 Fév 2018
Modifié(e) : Dabba Do
le 14 Fév 2018
IF: every A matches to a T, THEN: the output for an A or a T is the same. The same is true of G and C they are a pair. So there are only two pairs, why not try defining each pair as a 1 or a 0. So if A and T = 1 and G and C = 0 then: the sequence TGACTCAGTGTTCAATCTATGCC would be: 101010101001101110111000. By coding each codon with a 1 and a 0 you are going to con-volute the Bits in your code and they work as pairs representing a single genetic Bit.
Réponse acceptée
James Tursa
le 23 Sep 2015
Modifié(e) : James Tursa
le 23 Sep 2015
One way:
s = 'TGACTCAGTCGTTCAATCTATGCC'; % Input DNA string
[~,x] = ismember(s,'ATGC'); % Convert the ATGC into indexes
c = {'00','01','10','11'}; % Numeric strings to convert the indexes into
result = cell2mat(c(x)); % Convert the indexes into the numeric strings
Plus de réponses (4)
Bastien Chardonnens
le 23 Sep 2015
You can use
str = ('TGACTCAGTCGTTCAATCTATGCC');
[~,~,ind] = unique(double(str)-65);
dec2bin(ind-1)
0 commentaires
Suresma Jena
le 27 Août 2017
i want to how to convert a DNA sequence into binary. ex- if x = ATGCAT then its binary sequence will be xA = 100010 xT = 010001 xG = 001000 xC = 000100
6 commentaires
lakshmi boddu
le 8 Avr 2018
A pseudo random binary sequence of size 256 * 256 is generated with two 1 D logistic maps , from which 3-bit disjoint and consecutive binary sequences are extracted to choose DNA coding rule, as follows 000 ( 00-A,01-C 10-G,11-T) 001(00-A,01-G,10-C,11-T) 010(00-C,01-A,10-T,11-G) 011( 00-C ,01-T,10-A,11-G) 100( 00-G, 01-A,10-T,11-C) 101(00-G,01-T,10-A, 11-C) 110(00-T,01-C,10-G,11-A) 111( 00-T,01-G,10-C,11-A) . please help me sir how to implement in matlab
Siyab Khan
le 15 Jan 2019
Modifié(e) : Siyab Khan
le 15 Jan 2019
Please also write code for DNA sequencig in 4 bits
via this given schema
4 2 1 0
N = 0 0 0 1 N represents the gap in DNA sequence
A = 0 1 0 0
T = 1 0 0 0
C = 0 0 1 0
G = 0 1 1 0
0 commentaires
Khaled belkacemi
le 4 Avr 2022
Modifié(e) : Khaled belkacemi
le 4 Avr 2022
Hello,can someone help me to do the code for this situation? example of input data:0121212002202021101110002
and i want to code my data as this array
0 commentaires
Voir également
Catégories
En savoir plus sur Genomics and Next Generation Sequencing dans Help Center et File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!