Sequence Alignment: Chimera Alignment

Hello everybody!
I was wondering how we could create a code doing chimeric alignment? For more information about chimeric alignment see here.
The above link is the only source for reading I found on the Internet as well. Some useful details I know about the problem are: Let a virus infect a bacterium and modifies a bacterium reduplication process adding:
  • to each A(for adenine), a polyA having length from 1 to 5
  • to each C(for cytosine), a polyC having length from 1 to 10
  • to each G(for guanine), a polyG having random length >= 1
  • to each T(for thymine), a polyT having random length >= 1
Also, no spaces or additions into the modified by the virus DNA are allowed. E.g. the sequence AAATAAAGGGGCCCCCTTTTTTTCC is the infected version of ATAGCTC.
I have studied some kinds of sequence alignments and I am studying now this kind of alignment. I have made some conclusions (using nwalign and swalign) but I would like to get some advice about this topic (or some guidelines).
I would appreciate any kind of help and I am looking forward to reading your answers!
Thank you in advance!

Réponses (0)

Catégories

En savoir plus sur Get Started with Bioinformatics Toolbox dans Centre d'aide et File Exchange

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Translated by