How do I generate a random dna sequence without specific codons?
Afficher commentaires plus anciens
Hi all,
I am trying to figure out how to use randseq to generate a random dna sequence that excludes stop codons TAG, TAA, and TGA. I think it has to do with 'Case', but I am having difficulty finding information elsewhere.
Thank you!
Réponses (1)
Akira Agata
le 7 Mar 2018
randseq function does not have the option to exclude stop codons. The following is one possible solution to generate random sequence without stop codons.
% List of all possible combination
C = {'A','T','G','C'};
[x,y,z] = meshgrid(C,C,C);
list = strcat(x(:), y(:), z(:));
% Delete stop codons from the list
idx = ismember(list,{'TAG','TAA','TGA'});
list(idx) = [];
% Generate random sequence with N codons
N = 10;
idx = randi([1 numel(list)],1,N);
randSeq = [list{idx}];
The result is:
>> randSeq
randSeq =
'TGCATTTACAATGCCTCTCTAATTGAGCGT'
1 commentaire
Akira Agata
le 7 Mar 2018
More simple solution is to use randseq function and erase stop codons, like the following. But please note that this solution can not guarantee the output sequence length.
% Generate random sequence
randSeq = randseq(60);
% Erase stop codons
randSeq = erase(randSeq,{'TAG','TAA','TGA'});
Catégories
En savoir plus sur Genomics and Next Generation Sequencing dans Centre d'aide et File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!