Window length Selection size for DNA sequence?
Afficher commentaires plus anciens
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
Réponses (0)
Catégories
En savoir plus sur Genomics and Next Generation Sequencing dans Centre d'aide et File Exchange
le 28 Jan 2019
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
Translated by 
