Window length Selection size for DNA sequence?
2 vues (au cours des 30 derniers jours)
Afficher commentaires plus anciens
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
0 commentaires
Réponses (0)
Voir également
Catégories
En savoir plus sur Genomics and Next Generation Sequencing dans Help Center et File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!