Addition of two DNA sequenc

4 vues (au cours des 30 derniers jours)
lilly lord
lilly lord le 11 Juin 2020
Commenté : lilly lord le 13 Juin 2020
Hi, I have a problem in DNA addition
%%%%%%DNA addition
P_DNA1='ACAAGGGTTTAAACCCTTAC';
P_DNA2='TTTTGGGAAATGTGACATAT';
[m n]=size(P_DNA1);
mn=m*n;
d3=[];
for i = 1:mn
d3 = DNA_add('P_DNA1(i)','P_DNA2(i)');
end
where DNA_add is a function
  1 commentaire
lilly lord
lilly lord le 11 Juin 2020
DNA_add function
function K = DNA_add(Q1,Q2)
if Q1=='A' && Q2=='A';
K = 'A';
elseif Q1=='A' && Q2=='G';
K = 'G';
elseif Q1=='A' && Q2=='C';
K = 'C';
elseif Q1=='A' && Q2=='T';
K = 'T';
elseif Q1=='G' && Q2=='A';
K = 'G';
elseif Q1=='G' && Q2=='G';
K = 'C';
elseif Q1=='G' && Q2=='C';
K = 'T';
elseif Q1=='G' && Q2=='T';
K = 'A';
elseif Q1=='C' && Q2=='A';
K = 'C';
elseif Q1=='C' && Q2=='G';
K = 'T';
elseif Q1=='C' && Q2=='C';
K = 'A';
elseif Q1=='C' && Q2=='T';
K = 'G';
elseif Q1=='T' && Q2=='A';
K = 'T';
elseif Q1=='T' && Q2=='G';
K = 'A';
elseif Q1=='T' && Q2=='C';
K = 'G';
elseif Q1=='T' && Q2=='T';
K = 'C';
end

Connectez-vous pour commenter.

Réponse acceptée

Sujay C Sharma
Sujay C Sharma le 11 Juin 2020
Modifié(e) : Sujay C Sharma le 11 Juin 2020
Hi,
There are a couple of minor issues with your implementation that is causing a problem.
  1. Your function is missing an end statement.
  2. Assuming that you wanted to send the ith character of P_DNA1 and P_DNA2 to the function DNA_add, the quotation marks are not needed.
  3. The variable d3 gets overwritten at each iteration of the loop rather than the result of DNA_add being appended to d3.
Here is the modified code which should resolve these issues:
P_DNA1='ACAAGGGTTTAAACCCTTAC';
P_DNA2='TTTTGGGAAATGTGACATAT';
[m n]=size(P_DNA1);
mn=m*n;
d3=[];
for i = 1:mn
d3 = [d3 DNA_add(P_DNA1(i),P_DNA2(i))];
end
function K = DNA_add(Q1,Q2)
if Q1=='A' && Q2=='A';
K = 'A';
elseif Q1=='A' && Q2=='G';
K = 'G';
elseif Q1=='A' && Q2=='C';
K = 'C';
elseif Q1=='A' && Q2=='T';
K = 'T';
elseif Q1=='G' && Q2=='A';
K = 'G';
elseif Q1=='G' && Q2=='G';
K = 'C';
elseif Q1=='G' && Q2=='C';
K = 'T';
elseif Q1=='G' && Q2=='T';
K = 'A';
elseif Q1=='C' && Q2=='A';
K = 'C';
elseif Q1=='C' && Q2=='G';
K = 'T';
elseif Q1=='C' && Q2=='C';
K = 'A';
elseif Q1=='C' && Q2=='T';
K = 'G';
elseif Q1=='T' && Q2=='A';
K = 'T';
elseif Q1=='T' && Q2=='G';
K = 'A';
elseif Q1=='T' && Q2=='C';
K = 'G';
elseif Q1=='T' && Q2=='T';
K = 'C';
end
end
  1 commentaire
lilly lord
lilly lord le 13 Juin 2020
Thank you. Its a great help

Connectez-vous pour commenter.

Plus de réponses (0)

Catégories

En savoir plus sur Genomics and Next Generation Sequencing dans Help Center et File Exchange

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Translated by