DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show comments
Loading...
Problem Recent Solvers4
Suggested Problems
-
2477 Solvers
-
2349 Solvers
-
1363 Solvers
-
Find perfect placement of non-rotating dominoes (easier)
390 Solvers
-
We love vectorized solutions. Problem 1 : remove the row average.
896 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!