Binary to DNA sequence encoding - matlab
13 vues (au cours des 30 derniers jours)
Afficher commentaires plus anciens
Meghashree G
le 20 Sep 2015
Commenté : Image Analyst
le 5 Fév 2021
I am implementing DNA encryption algorithm.
For that, I have a vector containing binary values such as:
01100011 01110010 01111001 01110000 01110100 01101111.
Now, these values should be mapped to DNA sequence. How do I do that in MATLAB?
2 commentaires
Star Strider
le 20 Sep 2015
DNA has four bases (two complementary sets, A-T and C-G) and you have a binary sequence ...
Réponse acceptée
Image Analyst
le 20 Sep 2015
Perhaps this:
% Assign sample data.
binaryArray = [0,1,1,0,0,0,1,1, 0,1,1,1,0,0,1,0, 0,1,1,1,1,0,0,1, 0,1,1,1,0,0,0,0, 0,1,1,1,0,1,0,0, 0,1,1,0,1,1,1,1];
% Define base letters to choose from.
bases = 'ATGC';
for k = 1 : 2 : length(binaryArray)
% Convert these two digits into a number 1 - 4.
index = 2 * binaryArray(k) + binaryArray(k+1) + 1;
% Use that index to assign a letter to our result.
result((k+1)/2) = bases(index);
end
% Display in command window:
result
It shows:
result =
TGACTCAGTCGTTCAATCTATGCC
12 commentaires
Image Analyst
le 5 Fév 2021
Shiva, I'm not sure who you're asking, but personally I don't have any to give you.
Plus de réponses (0)
Voir également
Catégories
En savoir plus sur Cell Arrays dans Help Center et File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!