Community Profile

photo

Shlomo Geva


Last seen: 10 mois il y a Actif depuis 2017

Followers: 0   Following: 0

Statistiques

All
  • Thankful Level 3
  • Thankful Level 2
  • First Submission
  • Cody Challenge Master
  • Creator
  • Promoter
  • First Review
  • Commenter
  • First Answer
  • Solver

Afficher les badges

Feeds

Afficher par

Question


Issue with parfor when using containers.Map
Here is the code of a script that calls a function inside a loop. The function is passed a Map object (created previously). I ...

11 mois il y a | 1 réponse | 0

0

réponse

Question


generate all variations on a 20-mer, that are 1 to 4 mismatches away
We consider a kmer. An arbitray k long DNA sequence, consisting of only {A,C,G,T}. For instance, 'ACTGGTCATTTGGGCTGGTA'. Let'...

11 mois il y a | 1 réponse | 1

1

réponse

Question


"Warning: udp will be removed in a future release. Use udpport instead."
I do not call udp directly. This warning only appeared after upgrading to Matlab version R2022b from an earlier version. I sus...

environ un an il y a | 1 réponse | 0

1

réponse

Question


How to step through vector permutations in a parallel loop, without generating all permutations in advance?
I need a paralleised loop to step through all permutations of 1:N Even though for some values of N it is computationally feasib...

plus d'un an il y a | 2 réponses | 0

2

réponses

Question


How to generate M *almost* mutually orthogonal vectors of dimensionality N, where M>>N ?
Generating mutually orthogonal vectors in is easy enough. I am looking for vectors in , where , and the vectors are almost ...

environ 2 ans il y a | 2 réponses | 0

2

réponses

Question


How to return a uint64_t from a mex function?
I want to assign to plhs[0] a scalar of type uint64_t. Not sure what function to call. e.g. if I have uint64_t y=123; and I...

plus de 2 ans il y a | 1 réponse | 0

1

réponse

A répondu
how to get average of multiple rows and subtract from one group of average to another
Here is a solution to also take care of a number of rows that is not a multiple of your grouping (e.g. 30). I made up a matrix ...

environ 3 ans il y a | 0

A répondu
how to get average of multiple rows and subtract from one group of average to another
%% load the fille into memory with M = csvread(filename) %% loop around M, 30 rows at a time for i=1:30:si...

environ 3 ans il y a | 0

Question


Critical code section inside parfor
With C++ one can define critical code section inside a parallel for. Is there a similar construct that can be used with Matla...

environ 3 ans il y a | 2 réponses | 0

2

réponses

A répondu
k distinct combinations of size p without replacement
You can get this as follows: 1. First generate all binary vectors of size 2^N n=dec2bin(0:2^N-1)-'0'; in the examplll...

plus de 3 ans il y a | 0

A répondu
Find multiple elements in an array.
function out = findMultipleElements(a,b) % Find multiple elements in an array % example: % a = [1 5 2 5 3 5 4 2...

plus de 3 ans il y a | 0

Question


Strange "correct" solution to Cody Problem 58. Tic Tac Toe FTW
I see this solution on the Cody solutions list. Solution 1949216 I am puzzled as to how this could possibly be rated as correc...

plus de 3 ans il y a | 1 réponse | 0

1

réponse

Question


Cody challenge hard coded answers
I have been using something similar to the Cody Challenge problem solving rig for many years (albeit more sophisticated) in teac...

plus de 3 ans il y a | 1 réponse | 0

1

réponse

A répondu
MATLAB in research projects
I have used MATLAB since 1992. My first go-to platform. Every time. I am a tragic devotee. As a general computational platform...

plus de 4 ans il y a | 1

Question


PARFOR not using all logical cores
I have seen this quastion asked many times over several years, and I was notable to find a satisfactory answer, let alone a solu...

plus de 4 ans il y a | 1 réponse | 0

1

réponse

Question


How to generate a set of N mutually orthogonal (N being a power of 2) N-dimensional binary vectors [+1,-1]?
For instance: with N=2 we could have [1 1; 1 -1] with N=4, we could have [1 1 1 1; 1 1 -1 -1; 1 -1 1 -1; 1 -1 -1 1] How to ef...

environ 6 ans il y a | 3 réponses | 1

3

réponses

A répondu
blastformat function
I had the same problem, using Windows. I installed the NCBI blast suite. In the \bin file where it is installed there is a com...

environ 7 ans il y a | 0